60/150: A beautiful, colourful sea cucumber hiding its beauty in-between crevices
Animalia: Echinodermata: Holothuroidea: Dendrochirotida: Cucumariidae: Cucumaria: Cucumaria miniata Brandt, 1835
The Orange Sea Cucumber (Cucumaria miniata) is easily recognizable by its distinct orange pigment. This radiant colouration is the result of the pigment created by cinnabar or vermilion. Sea cucumbers are related to sea stars and sea urchins, they are all from the phylum Echinodermata, which feature radial symmetry and tube feet. Underwater, this creature displays its oral tentacles in the form of a bush for feeding, while keeping the remaining parts of its body hidden between the crevices of rocks. Their tubular feet act as anchors for them to be secured in one place. When removed from the water, its tentacles and tube feet retract and they look similar to a cucumber, getting the name sea cucumber. These marine invertebrates are known as suspension feeders, where their diet consists of plankton and any detritus around their habitat. Their tentacles, which are controlled by sphincter muscles, capture their food and draw it towards its mouth where it can be consumed. #Canada150 #Biodiversity150
Here’s the barcode sequence information for this species:
Process ID: DSPEC476-08
nucleotide sequence
CCTACTATTCGGTGCCTGAGCAGGAATGATCGGGACAGCAATGAGAGTAATTATCCGAACCGAACTCGCACAACCTGGATCCCTACTTAAAGACGACCAGATATACAAAACTATAGTGACAGCCCACGCCTTAGTCATGATTTTCTTCATGGTGATGCCAATAATGATAGGAGGATTTGGAAACTGATTAATCCCCCTAATGATAGGAGCCCCCGACATGGCCTTCCCTCGAATGAAAAATATGAGATTCTGACTAATCCCCCCTTCATTTATTCTCCTTCTGGCCTCCGCAGGAGTAGAAAAAGGAGCAGGGACCGGATGAACAATCTACCCCCCTCTATCAAGAAAAATTGCCCACGCAGGAGGGTCAGTTGACCTCGCGATCTTCTCTCTCCACCTAGCAGGAGCCTCTTCAATCCTTGCTTCAATAAAATTTATTACTACAATTATAAAAATGCGAAGACCAGGAATAACTTTCGACCGACTACCTTTATTTGTCTGATCAGTTTTCATAACAGCCTTTCTTCTTCTCCTTAGTCTCCCAGTACTAGCAGGAGCCATAACAATGCTCCTAACAGACCGAAACATCAAAACATCATTCTTCGACCCCGCAGGAGGAGGAGACCCTATACTCTTTCAACACTTATTC
amino acid sequence
LLFGAWAGMIGTAMSVIIRTELAQPGSLLNDDQIYNTIVTAHALVMIFFMVMPIMIGGFGNWLIPLMIGAPDMAFPRMNNMSFWLIPPSFILLLASAGVENGAGTGWTIYPPLSSNIAHAGGSVDLAIFSLHLAGASSILASINFITTIINMRSPGITFDRLPLFVWSVFITAFLLLLSLPVLAGAITMLLTDRNINTSFFDPAGGGDPILFQHLF
Learn more about it’s BIN (Barcode Index Number): BOLD:AAC2853
